Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12771G1
Clone ID IST12771G1
Vector VICTR76
Project tigm

Sequence tag IST12771G1BBF1
Sequence
ATGCCTTGCTAGGCTTGGCTGCCGGAAAGGAGGCCTGATCGTGCTGACTCATGGCGCTGGCTGCCCTGGAGGATAGAGCT
CANCAGGTCCCTCCCCTGCGCCTCCTGGCAGGCAGGGCTCAGCAATAGGACTTAGATAGAGACCATCTTCGAGGGGCCAC
GTATAGCTGTCCACAAAAACTGCTTCTGGCTAACTGANACTTGTCTGTGCTGCCAGAGGCTTGGGCAGCCCGGAAGAGAG
GCTGCCCAGTCAGGACCAGCATCCCTCCTGCATCCTGTGCTCTCAAGGTTCCAGGCAGGCCTCANAGGCAGCANCTGGGC
AACTCTCCTGACCCAAGGCCATGCAGGGAGCTTCGGAAGTGCCTACTCCTGTTGTCTTGGATCT
Sequence Type genomic DNA
Unitrap ID UNI32367

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 129506462..129506844 373
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029428 (Stx2) NM_007941 syntaxin 2 Gene [Source:MGI (curated);Acc:Stx2-001]


Sequence tag IST12771G1HMF2
Sequence
ATATAAAGTGCATAAAAAAATCAGGTGACAGCAAGTATAAGCCATTATTTACCAGTTACTATCTCCTAAATATGTCTTTC
ATGTAGCCATTTAACCCAAAAACAGTAATTGAGGCTCAAAGATATTGGACAATTTTCACTCCCTTTCGTGTCCAATATTT
CCGAAATGCTATCCAAATACTATAGAACCAGAAATAATTTGTAGAAATATTTCTGCACTTCTCACAGTGATTTATTATCA
GGTCTCTTTGGCTGTACCCACTGGCTTAGTGAAACAGAAAAAAAAATACNTTGTTTCACTTATGAAGTAANANTGATGAA
CTTTTCNCGTGTATATGGGTTTATTTTCTGTAGGCAAACTGTTGGTGTCCCTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 134372730..134373103 362
 
EST/CDNA Est Name
  BY718112.1

 
Come back to gene BY718112.1


For any suggestions or comments, please send an email to unitrap@crg.es