Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12274E3
Clone ID IST12274E3
Vector VICTR76
Project tigm

Sequence tag IST12274E3BBF1
Sequence
AGAGCACCCGACTGCTCTTCCAAAGGTCCGGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCTGTAACAAG
ATCTGT
Sequence Type genomic DNA
Unitrap ID UNI11991 UNI15874 UNI30929 UNI32895 UNI32896

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 30300701..30300785 85
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 77274106..77274190 85
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 21873440..21873524 85
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061544 (BC043476) BC043476 protein Fragment [Source:UniProtKB/TrEMBL;Acc:Q80ZY7]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 82702082..82702166 85
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 103146969..103147053 85
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 7315782..7315866 85
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 117444513..117444597 85
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 64909005..64909089 85
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032393 (Dpp8) NM_028906 dipeptidylpeptidase 8 Gene [Source:MGI Symbol;Acc:MGI:1921638]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 29457542..29457626 85
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 23711440..23711524 85
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 13143964..13144048 85
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 72757075..72757159 85
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 29611979..29612063 85
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053898 (Ech1) NM_016772 enoyl coenzyme A hydratase 1, peroxisomal Gene [Source:MGI (curated);Acc:Ech1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 18109801..18109885 85
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 87226848..87226932 85
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000082443 (AL954813.14)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 86728820..86728904 85
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 130624515..130624599 85
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 126843378..126843462 85
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001998 (Ap4e1) NM_175550 adaptor-related protein complex AP-4, epsilon 1 Gene [Source:MGI (curated);Acc:Ap4e1-001]


Sequence tag IST12274E3HMF2
Sequence
AGAGCACCCGACTGCTCTTCCAAAGGTCCGGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCTGTAACAAG
ATCTGACGCCCTCTTCTGGAGTGTCTGAAGACAACTACAGTGTACTTACATATAATAAATAAATAAATCTTAAAAAAAAG
AGAGAGAGAGAGAGAGAGAAGTGGATGACTGANTTCACAGANAAGGTCACTGAGGTCNCTGGGGACAGGANCCCAGGGGT
CTGGTGTGACAGGAAAGANCACTGTCATTGAGCTGTACCCCANCGCTATCATGTTAGGCATANAANACTTTTATTCNCTC
AGTGTGTGTTTGTGTGTGCACACGGGGCANGACATATGGAGAACANANGACACNNGTGGGAGTCNTTTGTCTCCTCNNAC
CCAANACTGANCCCNAGTCATTTTGCTTGGTGACNNNCACCTTTATCTGATAANCCNCCTCACTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000001998


For any suggestions or comments, please send an email to unitrap@crg.es