Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14781A11
Clone ID IST14781A11
Vector VICTR76
Project tigm

Sequence tag IST14781A11HMF2
Sequence
TGCACGTGAGTGCAGGTGCCCAAGGAAGCTAGAGGCTTTGGATCCCCTGCAGCCACTTGGATCTGAGCACAGTTGTTTGC
TTATGAGGCATTTACCAGTGTACTTACTTTCATGATTTCTCTTCTTGAACATGTGGGTTATATATTCTAGCAAGTTCCAG
TTTAGAAGGTCCTGATATGTGGAGAGTATGTGCATTGATTCCCTCCAACTTCAGATCAATAAATAAAGGATCAGGAGTGG
CTTACAGGAAGAAAAAAAATGGCTTGTTAGATAGTCTGACTGGCTGTGATAGACTTCCTAGATGGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI6252

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154290215..154290524 310
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038533 (Cbfa2t2) NM_172860 core-binding factor, runt domain, alpha subunit 2, translocated to, 2 (human) Gene [Source:MGI (curated);Acc:Cbfa2t2-001]


Sequence tag IST14781A11BBF1
Sequence
ACATCTTACCAGACTTTAAGACCGAGAACCAACCAACTGCCACCTCCAGCAGCACTGGTCTCTCCAGGCCAAGCTGGCAA
CAAGCTGAGGATGTGTACTCAATAACACACTCCTGTTTTTAGTTTGTTTTTGTTGTTTTATTTTTGAGACAGTCTATGTG
GCTCTGCCATCTGGAATCCACTATGTAGACCAGGCTGGCCTTGAACTCAGAGCTCTGCCTCCCTGTCTCCTGCACTGGGA
CTAAAGATGTGCACCATAACACTCAGCTTCCTGTCTCTACTTTAAACTTCTATAAACAAAGAGCAGACCTGGGTTTCCCG
TCTACTACCATGCCTGGGAAACTGGTAGACCAATGCGTTCTCAGTTCTGCCTGCATGAAGGCATAGTTCCTCTTCTGTGC
TCAGCCNGATTCTTGATGTAAGCACTCAGGTAGAATTCAACTTTCTAATATTACATCAAACAGGCAGTTGAGGCCTGGCC
TGGCCTTTATGTTGGGTTCTAGGACAACTAANANGTATGTANANAGTCTNANAAACNNGAGANAAANAAAANGCAGCTGA
GANNTCNTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114471016..114471587 542
 
EST/CDNA Est Name
  BB421125.1 - BI694075.1 - BQ031232.1 - C79377.2 - AW537405.1 - BE199976.1 - AW823507.1 - CR518704.1 - AU016648.1 - BQ175323.1 - AW548511.2


Sequence tag IST14781A11HMR1
Sequence
ATGTCTTAGGGACCNTCTTGTTGAGAAGTGTGCTTAAACTTAACAGTTGTGATCAATTCTGGGTAAACACTTCTCTCAGA
AATGGCTATTGGTCTGGTGAAGGTACCCAGCAGGTAAAGGTGCTTGCTTGGTGGCCTGAGTTTGATCTCTGGAACACACA
TTGTGGAAAGAGAGAACTGGATCCTACANATTGTCCTGACCTGTACACACACATAAAAACAATTGTTTTAAAAGAAAAGA
AAGGTGTGTTTTANGAGTGGCANAANATGTCNNANAANCNTGTGTCNNGCCGTCCCCACTCNNNTCTGGGTATTTTGGTT
TGGGTCCTGTTAAAAGTTCACCTCACAACCNNTGCCTTTCAAGGTTNACCGTGGTGGGCAAANAGTACCTGCCTTACCCC
ACTGNCCNCNCTTGCTGAAAGACNNCNNAACACATGAGCTGCNCNNCANANGNCTGNNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene BB421125.1 - BI694075.1 - BQ031232.1 - C79377.2 - AW537405.1 - BE199976.1 - AW823507.1 - CR518704.1 - AU016648.1 - BQ175323.1 - AW548511.2


For any suggestions or comments, please send an email to unitrap@crg.es