Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11631G9
Clone ID IST11631G9
Vector VICTR76
Project tigm

Sequence tag IST11631G9HMF1
Sequence
AAACAAACAAACAAACAATCAAAAAAACCCTGACCCAACCCAAACCAAAATGTGTTCCCATTCCTTGAAGCTGAGGAGTG
AGAGGGGTGANAGGGATCTTGTTTTTTTTTTTATNAAAAAACCNTTTT
Sequence Type genomic DNA
Unitrap ID UNI13863

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84885570..84885696 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]


Sequence tag IST11631G9BBF1
Sequence
AAACAAACAAACAAACAATCAAAAAAACCCTGACCCAACCCAAACCAAAATGTGTTCCCATTCCTTGAAGCTGAGGAGTG
AGAGGGGTGANAGGGATCTTGTTTTTTTTTTTATNAAAAAACCT
Sequence Type genomic DNA
Unitrap ID UNI13863

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84885570..84885692 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]


Sequence tag IST11631G9HMR1
Sequence
TTTGTTTGTTGTGACAGGGTCTTTCNGTGTANACTGGAACTCATTATGTANACCAGGCTGGCCTCAAACTCACAGACATC
TGCTGCCTTGGCCTTCCAAGTGCTGCAATTAACAGCAAGCACCACCATACTACCTACACTCTTCTAATAACTCACTCCTT
CTCTTGCATTACACACCCAGCCCTCTCCAAACAATGTACCTGCCTACATCTGGCTGCATGTACTCTGAACAAAGTGGAGT
ANTCACCTCCTTTGACAACTTTTAAGCTTTAACAGTCTGTGGAACACAGTATGCCCAATAAATGCTGATGTCAAGATTGA
ANANCTAATCCNACCTGAGCTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84885231..84885572 324
NO GENE  

 
Come back to gene ENSMUSG00000073633


For any suggestions or comments, please send an email to unitrap@crg.es