Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10017E7
Clone ID IST10017E7
Vector VICTR75
Project tigm

Sequence tag IST10017E7BBF1
Sequence
CTTAATTGGTGAGCAATCTCTCTGGCTTCTATTTGACTTTGTTGGTTTTGTATCCGTGGTTGTGTGCACTTGAGTACAGA
TGCACAGAAGCCAGGGCCTGTCTTGAAGCAGGAGTACACATGAGCCACCCAGTGTAACTGCTGTGAACTGAATTTGGATC
AAGTATTGACTAAAACTCGTGTCTCCCATATTAAATCAGTATCTTGTGTCTGTTGCTCTTTAGTATTTAGCAGCCCAATG
GTTCTTGGGTTAAATCTACATAGCTAATGAGTTAGTAATGAACTAGATAGAAGGCAACAGTGGGTCAGGCTGAGTATAGA
GATTTTCAAGAGGACACAAACATTAAGGAAGTTAGAGTTCCAGAAAGGAAATTTACAGCTCAAAACTGGAGTTAGACCAT
GAGGGGCTTTTTAAACTTTGTTAATTCTTCTAAACATTAAGTTAGGAAGATGGCTATATTCATCTTTTACCTCACTGAAC
TATAGTGGAAATATTAGACAAGTTATTTATCACCAATGTCAACCAGAATCAAATTTAGCGTAGTTGAGGGAAAAAAATTA
CATTTTATTTTAGTGCTAATTA
Sequence Type genomic DNA
Unitrap ID UNI15132

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 77381766..77382345 570
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029247 (Paics) NM_025939 phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoribosylaminoimidazole, succinocarboxamide synthetase Gene [Source:MGI (curated);Acc:Paics-001]

 
Come back to gene ENSMUSG00000029247


For any suggestions or comments, please send an email to unitrap@crg.es