Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15103H5
Clone ID IST15103H5
Vector VICTR80
Project tigm

Sequence tag IST15103H5HMR1
Sequence
TCGGNTCTGTTCCTTTGNAAAANACNTTGTATAACCNAAGGTGACCTTANCGCTCTGACCCTGCTGGGGTTATAGGCGTG
CANCACCACAGTTTTAGGTGGTACTANAGACCCNNACCGTGGCTTTCTACATACTANGTGAGCATGGCTGGTCACGCANG
GCCGAGGCAGGAGAGCCTGGAGTTTAAGATCANCCCATGCTATATATAAACTCTTTCCCACTAAATAAAGACATAAATAA
ATATTTTTAAATGTTAAAGTACTTAAGAGGCCACATCCCCAGCTCGTGTTAGCAGGAGGGATGGATACTACCGTTTCCTC
GATTACCCAGGATCAGCTGAGAAAGCAGGTGTAAGAAATTGAGTAACTGTGACGGATGGGCGCTCTGGGCCCGAATGCTT
TCCAGANACCCTTAAATCATCTCTGCGGGTGGCAAGGCCGGAGCACATGATCCTGCCTTCCCTGAGANACACTCTATTCT
CANAAGCTGTCAGANGCCCCTANTTNACGCATGCCCTTAATTTTCTGACTCTGGACACTTGTCCCAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 169186620..169187168 511
 
EST/CDNA Est Name
  BB657773.1 - BI556897.1 - CF540059.1 - BI657518.1 - BQ769267.1 - BG916516.1 - BG077442.2 - CF531737.1 - CN527345.1 - CB246953.1 - CN460679.1 - CX229581.1 - CA466639.1 - CX240707.1 - CX219622.1 - AA764207.1 - CJ069243.1 - BY729271.1 - BB665446.1 - CN665774


Sequence tag IST15103H5BBF1
Sequence
CCGATATATATGTACTGTTATATTATGTTTATTATAATATAAATAATATACTACTGGGGTCCTAGTAGTCCAACAACGGC
TGTCTCCTGACTAAAAGGCCAAA
Sequence Type genomic DNA
Unitrap ID UNI13682

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 169186522..169186623 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026558 (AC142244.11) NM_030724 Uridine-cytidine kinase 2 (UCK 2)(EC 2.7.1.48)(Uridine monophosphokinase 2)(Cytidine monophosphokinase 2) [Source:UniProtKB/Swiss-Prot;Acc:Q99PM9]

 
Come back to gene ENSMUSG00000026558


For any suggestions or comments, please send an email to unitrap@crg.es