Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10827G10
Clone ID IST10827G10
Vector VICTR76
Project tigm

Sequence tag IST10827G10HMF1
Sequence
ATGTCATCCTTAAGAAGTAATCCATGTGAGCTGGGGTTTTTTTTTTTTN

Sequence Type genomic DNA
Unitrap ID UNI16328

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20505996..20506043 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]


Sequence tag IST10827G10BBF1
Sequence
CTCCCCTCGAAGTTTATCTAGATGTGGGATGGCAGGGTCAGCACCAGCAAATAGCTCCCGCTCTGAGCTCGGACTTCCAC
CCAAACCCACCCTACACCTGTTTCCCCAACTGTGAGGCCCCANCAGGCCCTGGCCCCATTCCAGCTTCAGTTACATCATC
TAAAACAGGAACAAACACACCTAAAGGCCACAGAACTGGCAGCTTTCCCTAAAGTTGTTTGGCTAACCCCAAGTGGGTTG
TGCACAGGAAGGCCATGACCTCCTCACACGCCCCACCCTGCCTTATTGCTCATCCTCCCAACCCGATGTCCAGCTCCCAC
TANAACTCANGTCTAGCAGATTTGGGAGCCTGGGACGACAGGAGTTTTCATATGCAAATATTCCTATGTTGTGCTCTGTG
AATGACCCTGTCTTATGGCCCTGTGTGACGTTGCCTTCAATCACACGCAGTCTCAGTCCTCTCCAAACANGAAGANGGTT
TCNNGCCTTACAAGATGTTATCCATAGTNNAATAGGCCNCCACGAGTCACAGCCCANTCTTAACCGCAGCANTNNGNNCT
GGTNNTAAACAN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 88435153..88435723 535
 
EST/CDNA Est Name
  BM932766.1

 
Come back to gene BM932766.1


For any suggestions or comments, please send an email to unitrap@crg.es