Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12259A8
Clone ID IST12259A8
Vector VICTR76
Project tigm

Sequence tag IST12259A8HMF2
Sequence
ATTTAATTTGCAACGGTCGTCCTCACAGTATGGTCTTAGAAGATGCAGCTTCCTCATGGGTTTCATTTTTCTGCTCCTTT
TAAGCAGGAGGCAGCCGCTTTGGAGCGTANAGGACGCGGGAAAACTTAACCCCTTTAGTCCCCCACCTTTTCTAGAAGCT
AACGACCAGGTCTTTGTGGGTTTGTCTTGCAACCTGACCACGTTTCCTGTCCGAGGCCTTGGAGCTTCCCCAGGCCTGGG
TATGGGTCCTTTTGTGTGTACAGCTACAGGA
Sequence Type genomic DNA
Unitrap ID UNI32050

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 23961949..23962218 268
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024277 (Mapre2) NM_153058 microtubule-associated protein, RP/EB family, member 2 Gene [Source:MGI (curated);Acc:Mapre2-006]


Sequence tag IST12259A8BBF1
Sequence
ATCCAAGCAGGGCTGGAAGATGAACTCAGTCCAGTGTGGGCACATTTCTCTCTGGTTCCTACTGAGTCCTACTGGTTCCT
ACTGAAGTCCTGGGCACAGGAGGCTGCCCCTGGGGTAGATGCTGTCCTGTAAGGGATGTGGGAGATCAGACAGGACAGCA
GCAGACATCCACATTTAAGGAGGGGGTGGAGAAAGAGAGGCCACCAAAGGAAATGTCGGAGGTCAGAGGGAAAGTCTCTG
TCAGACCCCAAGGCCGCCAGAGACGGTGGGCCAGGACCCCTCCTCCCCATAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 47708899..47709194 296
NO GENE  

 
Come back to gene ENSMUSG00000024277


For any suggestions or comments, please send an email to unitrap@crg.es