Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13438H6
Clone ID IST13438H6
Vector VICTR74
Project tigm

Sequence tag IST13438H6HMR1
Sequence
CTCTAAGTTCTGCCTGTAGCATTTAATATGGAGGTGTAAGATCCATTTGGAGTTAATATTGTGGAGGCTGTAAAAGCCCT
ATCATATGTTGAGTAGCACTTCAATATTAAGCTGTGATGTAGAAGAGTAGAATTGATGATGCTAAAGACTTAATTGGGAA
GTAGGAAGTGGCACCNNNTANAAAGTANCAGAGAGAGGACTGCCTGTAAAACACCCCCCCCCCCN
Sequence Type genomic DNA
Unitrap ID UNI7604

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 150310211..150310434 214
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074731 (Zfp345) NP_001030072 zinc finger protein 345 Gene [Source:MGI (curated);Acc:Zfp345-001]


Sequence tag IST13438H6BBF1
Sequence
NNNAAAATAGANAANCTGCGGTTCTCANGGTTGGCATCCNGCNNANTATTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000074731


For any suggestions or comments, please send an email to unitrap@crg.es