Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14749H7
Clone ID IST14749H7
Vector VICTR76
Project tigm

Sequence tag IST14749H7HMR1
Sequence
GCAACATTAGTCNTACTTAACTTTATGCATCTCAGTGAACTTGTATAAAGTTAGAGCAGTCATTCTGAAGCTATGGAGAG
TCACATTGGATTTTTATGTGTCCTTTATAAAATGTATCTTATGTATTTATCTCCCACCAAAAATAAATAAATAATTGATC
CAAACATTTTTGCAGCCGGGCGTGGTGGCGCACGCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGCGGATTTCTGAG
TTCAAGGCCNNCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTATNCAGANAAACCCTGTCTCNAAAAACCNAAA
AAAAN
Sequence Type genomic DNA
Unitrap ID UNI7146

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56868149..56868472 310
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038816 (Ctnnal1) NM_018761 catenin (cadherin associated protein), alpha-like 1 Gene [Source:MGI (curated);Acc:Ctnnal1-001]


Sequence tag IST14749H7HMF1
Sequence
TTGCTTTGTGGTTGATTTTCTTTTTTTACAGGTTTTTTTAAGTTGGTTTGGTTTGGTTTTCATCTGTCTCTCTGTGTAGC
CCTGACTGGCCTCANAAATCGACCTGCCTCACTCTCCCAAATGTTANAATCAAAGGTATATTTCATGGCATCTGGATGCA
AGTTCTTTATAATAAAGCTTTAATACACTTAAAGAATGAATAAGCAAACCATTCCCTGCACCCGCGGCCCCCCCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56868469..56868703 231
 
EST/CDNA Est Name
  BY019096.1 - CJ055526.1 - BY148848.1 - CJ071032.1


Sequence tag IST14749H7BBF1
Sequence
TTGCTTTGTGGTTGATTTTCTTTTTTTACAGGTTTTTTTAAGTTGGTTTGGTTTGGTTTTCATCTGTCTCTCTGTGTAGC
CCTGACTGGCCTCAGAAATCGACCTGCCTCACTCTCCCAAATGTTAGAATCAAAGGTATATTTCATGGCATCTGGATGCA
AGTTCTTTATAATAAAGCTTTAATACACTTAAAGAATGAATAAGCAAACCATTCCCTGCACCCGCGGCCCCCCCCCNNNC
CCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56868469..56868704 236
 
EST/CDNA Est Name
  BY019096.1 - CJ055526.1 - BY148848.1 - CJ071032.1

 
Come back to gene BY019096.1 - CJ055526.1 - BY148848.1 - CJ071032.1


For any suggestions or comments, please send an email to unitrap@crg.es