Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10459D7
Clone ID IST10459D7
Vector VICTR76
Project tigm

Sequence tag IST10459D7HMR1
Sequence
TGGTCAGGTTTACTAGCACAGTGAAGACCCTTGAAGGTTTCACCTTTGAGTTTTGCATTTTAGGCGCCAAGCCCATCTGT
GTGTGCTCGCATCCAACTGTGATGAGCCCATGTATGTCAAGCTGGTGGAGGCACTTTGTGCTGAGCACCAAC
Sequence Type genomic DNA
Unitrap ID UNI576

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 23505723..23505873 151
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061983 (AC160147.6) NM_011295 40S ribosomal protein S12 [Source:UniProtKB/Swiss-Prot;Acc:P63323]


Sequence tag IST10459D7BBF1
Sequence
CCAATACCACACATTATAATAGGAAACCTATTTATGGCCAAAGGAAACTATGACCACTTTCAGGGTATTTCCAACTTGAA
AGCTGATCCAAAGCAGTCCTGTGCAGGAAGCACTGTAAATATTCACAACAGCATCCAAAATCACCTGACTTTACCTCAAA
CAGTAGAATACACGTGCATAAGCCTAATAAACCATGCATGTTCTCAAGTCTCCCGGATATAGCTAGATTTCCCCGACACC
ACAATATTGTCGTTNAAGTATTTGCAAACTAAATAATGATGCCCCCCCCTTTTCCATCTTCTAGCAAAACTACCGGACTA
TCTATCCCCACGAGCTACAGGTTTGTCAGACTANCTGTTTCTNACCCATGAACNNNNTGAANGGGTATCCGACAATTCAA
GTCATCATGCAAACACTGNAGCTTTACAAAACTACTGCTCGTCATCCCCGATCCACACAGNAACCCACACATNCTAAGTG
GGCTNGAGTTGATACCTTTTNCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 23505936..23506435 476

 
Come back to gene Mmu.16731


For any suggestions or comments, please send an email to unitrap@crg.es