Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13145G11
Clone ID IST13145G11
Vector VICTR74
Project tigm

Sequence tag IST13145G11BBF1
Sequence
CTGGGAGACAGATTCTCTCCTCTGAGTTTCAGTGCTCANAGCACTCTCTGCTGGCAAGCTCTCTTACAGGGAAGGTGCGC
AGATATCTTGTATTTGGACCTCCTCCTGGCCGAANAANAAGGCCCAAAACAGGACCTTTCTCANACACTGTGTTGCTTTG
GCAGTTCCCAGGTGGTACAGACTCTCACCTAAGCAGACTAAATTCCTAAGTTCCTTGGAGTCCCGGGACCAAGATGGCGA
CCGCTGCTGCTGTC
Sequence Type genomic DNA
Unitrap ID UNI15225 UNI30809 UNI30810 UNI30811 UNI31345 UNI31845 UNI31952

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 20647616..20647868 245
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 43875982..43876234 245
 
EST/CDNA Est Name
  DV075707.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 14900536..14900788 245
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 19145559..19145811 245
 
EST/CDNA Est Name
  BI320042.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 4724885..4725137 245
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022181 (C6) NM_016704 complement component 6 Gene [Source:MGI Symbol;Acc:MGI:88233]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 6672793..6673045 245
 
EST/CDNA Est Name
  BY302409.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 13432042..13432294 245
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020576 (CT025539.18) 4933425L03Rik protein [Source:UniProtKB/TrEMBL;Acc:Q6PGH6]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 7826523..7826775 245
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 11416415..11416667 245
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 7462032..7462284 245
 
EST/CDNA Est Name
  BY101325.1 - CA464211.1 - BY124670.1 - BY131543.1 - BU846768.1 - BF149456.1 - AI614851.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 5255663..5255915 245
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019769 (Syne1) NM_022027 synaptic nuclear envelope 1 Gene [Source:MGI Symbol;Acc:MGI:1927152]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 6638192..6638444 245
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 9094879..9095131 245
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046178 (Nxph1) NM_008751 neurexophilin 1 Gene [Source:MGI Symbol;Acc:MGI:107492]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 5110520..5110772 245
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3987322..3987574 245
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040407 (Akap9) NM_194462 A kinase (PRKA) anchor protein (yotiao) 9 Gene [Source:MGI (curated);Acc:Akap9-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 12252572..12252824 245
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 5054978..5055230 245
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 4906422..4906674 245
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 14209610..14209862 245
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026712 (Mrc1) NM_008625 mannose receptor, C type 1 Gene [Source:MGI (curated);Acc:Mrc1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 11616276..11616528 245
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057715 (A830018L16Rik) NM_177173 RIKEN cDNA A830018L16 gene Gene [Source:MGI Symbol;Acc:MGI:2444149]


Sequence tag IST13145G11HMF1
Sequence
NTGGGNGACNNATTNNNNCNNCTGNNTNNNNTGCTNANANCACTCNCTGCTGGCNAGCTNNNTTANNNGNAANGTGCCCA
AATNNCTTGTATTNGAACNTCCNCCNGGCCNAANAAAAANGCCNNNNNNAGGACCTTTCTNANACACTGTGTTGCTTTGG
CANTTCCCANGTGGTACANACTCNCACCTAANCANACNNAATTCCTAANTTCCTTGGANTCCNNGGACCAAAATGGCGAC
CGCTGCTGCTGTGGCTTANGCCGCCTCCCCAGCCGGGTGGGCACCTGTCCTCCGGTCCGGAAGGTGGCCNNNNGTCCCCG
GCCNNCACAGGGTGCTGCCNNANCNCNTCTGTGCTTCCGCCTGTTCNNNAANCTGTCANGTTCNCTGGCNCACCCTCTCA
CCTGTTNANACTANTTTCCNAAGTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000057715


For any suggestions or comments, please send an email to unitrap@crg.es