Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W257E04
Clone ID W257E04
Vector ROSAbetageo
Project ggtc

Sequence tag W257E04
Sequence
AGCGTTGTTGAGGGCGGCCTGGGGTGAGAGCGAGGCTGCGGAGCAGGCGAGACGACGGGCGCTAGAGAGGACGCGGCGCT
AGAGTGGCGGTGCAAAGGGACCTGAAGCCCGTAGCCCGGCCTGGGGCCGGCGAGACGGCCGAGGCGG
Sequence Type mRNA
Unitrap ID UNI12182

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25862259..25862405 147
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045252 (Zfp574) NM_175477 zinc finger protein 574 Gene [Source:MGI Symbol;Acc:MGI:2442951]

 
Come back to gene ENSMUSG00000045252


For any suggestions or comments, please send an email to unitrap@crg.es