Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14374F7
Clone ID IST14374F7
Vector VICTR74
Project tigm

Sequence tag IST14374F7HMR1
Sequence
TGCTTTTGCCTGCTTTACCCTGCTCCTCCAATTCCATGCCTCCTTCCTGTTGTCTTTAGTGTTTGGGTCTAAAAGGATGG
CAAGGGAAAAGGGTGAGTGGTGAGTGCTGGGGACTCNGCTGT
Sequence Type genomic DNA
Unitrap ID UNI13304

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 31616177..31616298 120
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026842 (Abl1) NM_009594 c-abl oncogene 1, receptor tyrosine kinase Gene [Source:MGI (curated);Acc:Abl1-001]


Sequence tag IST14374F7HMF1
Sequence
GCAACAGGCTCCTGGCTCTAAGTTTATGCAAAGAACAAAACATGAGGGGCTCCCTCACCAAGCATCAAACTGGAAGCTCT
CAAAACTCCTGGAAATACAAGCAAAACCATTCTTTCTCTTCTAAAAAGAGACAATCCCCAAGACCTCTTCATGGTCTGCA
GAAAGGTGGGGGTGGGGGTGGAAAGTTCACATGAAATTCTGTACCCATAAATGGTANAGCGGGATCCCTTTGTACNCNGC
ACTTGGTGTAGGTCCACCTTTGTGACATACAANTCCCAGTTGGCAGTGGAAACACCACAACGTGNGCTCNNNNNGACCTT
ANNGCCTGNNNCNCTGACNTNNNNANACTTTCTGGGCNNGAGCCNCNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14374F7BBF1
Sequence
ACAACNGGCNNNNGGCTCTAANTTTANGCNNNGAACNNAACATGAGGGGCTCCCTCACCAATCATCANACTGGAANCTCT
CAAAACTCCTGGAAATACAANCNAAACCNTTCTTTCTCTTCTAAAAAGAGACAATCCCCAAGACCTCTTCATGGTCTGCA
GAAAGGTGGGGGTGGGGGTGNAAAGTNNNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000026842


For any suggestions or comments, please send an email to unitrap@crg.es