Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14147E10
Clone ID IST14147E10
Vector VICTR74
Project tigm

Sequence tag IST14147E10HMR1
Sequence
GTCCCATGCTGTCGTTAAATGACATGTAGTTAATTTACATGGTGGATCGTGCACGTGTCACAGCGCCTGTGGAGGTCNNA
GGANAACTTTACACAAGGTTGTTATTTCTTTGCACCACGAGGGGCCTGGGAATCCAACTCAGGGTGTCATGCTTGGCTAA
GTGCCCTTACCAGCTGAGCCATTTTTGGAAGTTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI8009

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29903663..29903872 204
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039715 (Wdr34) NP_001008498 WD repeat domain 34 Gene [Source:MGI (curated);Acc:Wdr34-001]


Sequence tag IST14147E10BBF1
Sequence
GGGACCCCTAAGAGTTCTGTTGTCCTGGTTTGCTTTTGTTGTTGTTTGTTTTCGTTGGTTGGTTTCTTTCTCCTCAGAGA
CCGAAAAAAAGGCTAACGCGAAAGCATCTGTGAGTTTTTTCATTAAAACATGAAAACACGCGGACCAGTGGTGGCGCACG
CCTTTCGTCCCAGCACTTGGGAGGCAGANGCAGGCGGATCTCTGAGTTCCAGGACAGCTAGGGATGGATACTCAGAGAAA
CNCTGTCTCGAAAAAACAAAAACNAAAAAGCCGTGAAAACNCAACGCTGCGCCNGGCCTTCCCGCCCGCGCTGCCNTAGC
GGGCCCGCGCCCTCACCGTCTCCCCGCGGANCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29903868..29904217 338


Sequence tag IST14147E10HMF1
Sequence
GGGACCCCTAANAGTTCTGTTGTCCTGGTTTGCTTTTGTTGTTGTTTGTTTTCNTTGGTTGGTTTCTTTCTCCTCANNNA
CCGAAAAAAAGGCTAACGCGAAAGCATCTGTGAGTTTTTTCATTAAAACATGAAAACACNCGGACCANTGGTGGCGCACG
CCTTTCGTCCCANCACTTGGGANGCANANGCANGCGGATCTCTGANTTCCAGGACAGCTANGGATGGATACTCNNANAAA
CCCTGTNTCGAAAAAACNAAAACAAAAAANCCNTGAAAACACAACGCTGCGCCNNGNCTTCCCGCCCGCGCTGCNNTANC
GGGCCCGCNCCCTCACCGTCTCCCCNCGGATCCCCNGGACNCNCCTCCNCTGNNANGGCNNGGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene Mm.88053


For any suggestions or comments, please send an email to unitrap@crg.es