Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11631D8
Clone ID IST11631D8
Vector VICTR76
Project tigm

Sequence tag IST11631D8HMF1
Sequence
CCGAGTGCTGAGATTAAAGGCGTGCACCACCACACCCGGCTAT
Sequence Type genomic DNA
Unitrap ID UNI31127

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 23714826..23714866 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062012 (Zfp13) NM_011747 zinc finger protein 13 Gene [Source:MGI Symbol;Acc:MGI:99159]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 48662549..48662589 41
NO GENE  

 
Come back to gene ENSMUSG00000062012


For any suggestions or comments, please send an email to unitrap@crg.es