Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A053E01
Clone ID A053E01
Vector pT1betageo
Project ggtc

Sequence tag A053E01
Sequence
CTTGTCTTTAGCTTCAATGATAAGCTCTTTGGATTACTGGTGAAGGACATTGAAGCCATGGATCCCAGCATCCTGAAGGG
AGAGCCTGCATCAGGCAAAAGGCAGAAGATTGAGGTAGGCCTGGTTGTTGGAAACAGTCAAGTTGCATTTGAAAAAGCAG
AAAATTCGTCGCTCAATCTTATCGGCAAAGCTAAAACCAAGGAAAATCGCCAGTCCATCATCAATCCCGACTGGAACTTT
GAGAAAATGGGGATCGGCGGTCTGGATAAGGAGTTCTCGGACATTTTCCGAAGAGCATTTGCTTCTCGGGTGTTCCCCCC
GGAGATCGTGGAACAGATGG
Sequence Type mRNA
Unitrap ID UNI9

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 103771757..103775222 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034187 (Nsf) NM_008740 N-ethylmaleimide sensitive fusion protein Gene [Source:MGI (curated);Acc:Nsf-001]

 
Come back to gene ENSMUSG00000034187


For any suggestions or comments, please send an email to unitrap@crg.es