Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14888F9
Clone ID IST14888F9
Vector VICTR76
Project tigm

Sequence tag IST14888F9HMR1
Sequence
AGTGGAGGTGTCTCAGACTCTCCGGGAGGCAGTAGAAAGTTCTAGGATAGCAGCTGGAAGAGGGGACACCANCGTCACCG
GCTATAGCCNCCCTCAGCCGGTCTACCTTAACAGACATTAGCTAGAAGCTGGA
Sequence Type genomic DNA
Unitrap ID UNI30842

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 116674576..116674707 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020814 (Mxra7) NM_026280 matrix-remodelling associated 7 Gene [Source:MGI (curated);Acc:Mxra7-001]


Sequence tag IST14888F9BBF1
Sequence
ATGTAAGTACACTGTAGCTGTCTTCAGACACTCCAGAAGAGGGCGTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI20768

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165754: 363594..363646 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000072258 (Taf1a) NP_067441 TATA box binding protein (Tbp)-associated factor, RNA polymerase I, A Gene [Source:MGI Symbol;Acc:MGI:109578]

 
Come back to gene ENSMUSG00000072258


For any suggestions or comments, please send an email to unitrap@crg.es