Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10922A1
Clone ID IST10922A1
Vector VICTR76
Project tigm

Sequence tag IST10922A1BBF1
Sequence
GTGAAGATGATGAGGGAGGGGAGAGAGATTGCTTAACCTCACATACACTGGCAACGCATGAGGAGAGTTAACACGTTCAG
TCAGAAGCCACTCCTCCTGGGGGGTCACAATCATAATGTGGAATGGTTTTCCTCTTGTTCTGTCTCAGTGTGCTGTGTGA
AAATGTCATGGTTCCTACCCTCCCGTTGCTTCCCAGATACTTAGAGTCCCTGAGGAGATCTG

Sequence Type genomic DNA
Unitrap ID UNI15985

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66506974..66507194 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019873 (Reep3) NM_178606 receptor accessory protein 3 Gene [Source:MGI Symbol;Acc:MGI:88930]


Sequence tag IST10922A1HMF2
Sequence
CCACCATCTGGTTGCTGGCATTTGAACTCAGGACCTCTGGAAGAGCAGTCAGTACTCTTAACCGCTGAGCTATCTCTCCC
TGTCAGCTGTACGATCTGTCCAAGCGCCTGTATTTCTGTCTTCCTTTCCCATCACACTTCTTTCTTATCTACTAATGATC
AAGAACATGAGCGGGCATGCCACGAACAGAATTTCTCATACTTGTTTAAAATGATAAGCTACACTTATGTCATATGTTGC
TCTATAATAGGATGTTTTTTATTTTGCTCTGCCTTTCTTCCTTGTGCGGGGAAAGGGTATACCTCAAGACAAAAGAGCAG
GTCTATGAAATCATGACACAATATANAAGTCCAAACAAAGTCNGGGCTANCNNTCTTTTAATGTGTGTATGTGTTTCCTC
CTCTACTGTANNNAAATTAATATTTAGAGGGATGATCCACAATATATTTGAGAAGCAACACTTGAAAACTTACTAGTTAN
GCTAAAGAGACAGCCTANCANTNNAAAATACTTTGNTTCCCTTGTNNAANNCTAGGGACAGTTTCCCANAN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 34723196..34723740 504
 
EST/CDNA Est Name
  BX511501.1 - DV055993.1 - DV046604.1 - BE864973.1 - CJ046813.1 - BY707409.1 - AA967935.1 - BY728944.1 - AA790324.1 - AI157524.1 - CA478190.1 - CA467827.1 - BU937799.1 - BE625331.1 - AA286346.1 - AA734518.1 - BB633741.1 - BE850881.1 - AA764308.1 - AA637762

 
Come back to gene BX511501.1 - DV055993.1 - DV046604.1 - BE864973.1 - CJ046813.1 - BY707409.1 - AA967935.1 - BY728944.1 - AA790324.1 - AI157524.1 - CA478190.1 - CA467827.1 - BU937799.1 - BE625331.1 - AA286346.1 - AA734518.1 - BB633741.1 - BE850881.1 - AA764308.1 - AA637762


For any suggestions or comments, please send an email to unitrap@crg.es