Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A043D03
Clone ID A043D03
Vector pT1betageo
Project ggtc

Sequence tag A043D03
Sequence
GNGGGGGNCACNNGGNNNCCCTCGGGCTTTTCTGTGCCAANNTCNNCGGCNNCANNTGCCCCGNNCCCACCTCCCGTCCA
GGTTNNGGGCCAAACACGCGGGTCCNNCCCCCCCCGCCGAGGGCGGGGGGGCNNCCCCAATTGGAGGGGACCGGGGCGCC
CCCCGCACCGGGCCCCAGGGTGGCCCGCCCCGTTAGTGTAGNNAAGGGAAAAAGGAGGCATATCTGCCACAGAGACTCCA
AACTNNNCTTCTTACTTCGGGACTCCCTTGGTGGCAATGCCAAAACAGCTATAATTGCAAATGTTCATCCAGGATCCCGG
TGTTTTGGAGAAACACTGTCAACACTTAATTTTGCTCAAAGAGCCAAGCTGATTAAAAACAAGGCTGTGGTAAATGAAGA
CACCCAAGGAAATGTCAGCCAACTGCAAGCTGAAGTGAAAAGGCTCAAAGAACAACTGTCTCAATTTACTTCTGGGCAGA
TAACACCAGAAAGCTTAAGGCCAGAG
Sequence Type mRNA
Unitrap ID UNI12188

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 122888645..122894041 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036768 (Kif15) NM_010620 kinesin family member 15 Gene [Source:MGI Symbol;Acc:MGI:1098258]

 
Come back to gene ENSMUSG00000036768


For any suggestions or comments, please send an email to unitrap@crg.es