Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13714H6
Clone ID IST13714H6
Vector VICTR74
Project tigm

Sequence tag IST13714H6HMF1
Sequence
TGAGGATGTANCCCAGGTTAATANAATAGCTTGTCTTGCATGAATGAAGCTTANAGTTGGATCCCTAGTATCACATATGG
TGAGTGTGTTGGTGCACACCTGTAATGCCAATGCTGAAATGGTAAAGGCAGAANAGTCAAAAGTTAAAGGTCTTCTGTAA
CCAGCTGTTC
Sequence Type genomic DNA
Unitrap ID UNI32912

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91610270..91610438 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040506 (Ambra1) NM_172669 autophagy/beclin 1 regulator 1 Gene [Source:MGI (curated);Acc:Ambra1-001]


Sequence tag IST13714H6BBF1
Sequence
TGAGGATGTANCCCAGGTTAATANAATAGCTTGTCTTGCATGAATGAAGCTTANAGTTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000040506


For any suggestions or comments, please send an email to unitrap@crg.es