Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10297E12
Clone ID IST10297E12
Vector VICTR76
Project tigm

Sequence tag IST10297E12BBF1
Sequence
AAGCCTCTTAGGTTCTCAAGCACCTANACTCGGAGCACCCCGCCTTGGGGGCCAGTAGACAGCCATGATGCTCACCTGGA
AGCTGCTAGGCCTGCTGGTCCTTTGCCTGTGTGCAGGAGGTGAGTCGTCAGAATAGGCCAGGAGCACAGCTGGGGTGATG
GAGATGGTCGAAATGACCCACCCTTAGGGAGGGGACGCCCCCAGGAGGAAAGGAGTAAGAGGAACGCANAGCANAAGGGA
TTCTTGGAGTGTCCTTANTGGGGAAGCTCANGGGATTGCAGGCNNGGGCACCTTGATTCTGAATATGTTGCTGGGTCAGG
TGGAGGGATGCNATAGAGTTGTGTGGAGTCACCAGGCCTAGGGAGTCACTGGGACTGANGGCTGGTTATTACAGANATGG
CGCCTGAGTGACAGGTGGNGNCNAGACCNCTTCCAGTGCAGACNACCCTGGGGGANGTTCCAGTGGANTATCCCAACCAA
GGTTGAACAGAGAACN
Sequence Type genomic DNA
Unitrap ID UNI28708

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35670121..35670615 461
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024409 (Psors1c2) psoriasis susceptibility 1 candidate 2 (human) Gene [Source:MGI Symbol;Acc:MGI:1930025]


Sequence tag IST10297E12HMF1
Sequence
AAGCCTCTTAGGTTCTCAAGCACCTANACTCGGAGCACCCCGCCTTGGGGGCCAGTAGACAGCCATGATGCTCACCTGGA
AGCTGCTAGGCCTGCTGGTCCTTTGCCTGTGTGCAGGAGGTGAGTCGTCAGAATAGGCCAGGAGCACAGCTGGGGTGATG
GAGATGGTCGAAATGACCCACCCTTAGGGAGGGGACGCCCCCAGGAGGAAAGGAGTAAGAGGAACGCANAGCANAAGGGA
TTCTTGGAGTGTCCTTAGTGGGGAANCTCANGGGATTGCAGGCNNGGGCACCTTGATTCTGAATATGTTGCTGGGTCAGG
TGGAGGGATGCGATAGAGTTGTGTGGAGTCACCAGGCCTAGGGAGTNACTGGGACTGANGGCTGGTTATTACAGAGATGG
CGCCTGANTGACAGGTGGGGCCNAGACCACTTCCAGTGCAGACNACCCTGGGGGANGTTCCAGTGGANTATCCCAACCAA
NGTTGAACAGANAACCNTTTGGAAGTATGATCGTGTCAGTGGTCCGGATGAGCCTANGGCTTTCAN
Sequence Type genomic DNA
Unitrap ID UNI28708

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35670121..35670665 509
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024409 (Psors1c2) psoriasis susceptibility 1 candidate 2 (human) Gene [Source:MGI Symbol;Acc:MGI:1930025]

 
Come back to gene ENSMUSG00000024409


For any suggestions or comments, please send an email to unitrap@crg.es