Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BC0223
Clone ID BC0223
Vector pGT2lxr
Project sanger

Sequence tag BC0223
Sequence
TCCTTTGAAGACAGCGAGGAGGACTTCGACTCCAGGTTTGATACAGAAGATGAACTTTCCTACCGGCGAGACTCTGTGTA
TAGCTGCGTCACACTGCCGAAGTTCCACAGTTTTCTGTACATGAAAGGTGGCTTAATGAACTCCTGGAAGCGCCGCTGGT
GTGTCCAGAAGGACGAGACCTTCTTGTGGTTTTTTTCCAAGCAGGAAGCCCTCAAGCAAGGCTGGCTGCACAAGAAAGGC
GGGGGCTCCTCCACGCTGTCCCGGAGGAACTGGAAGAAGCGCTGGTTTGTCCTTCGCCAGTCGAAGCTGATGTACTTTGA
AAACGATAGCGAGGAGAAGCTCAAGGG
Sequence Type mRNA
Unitrap ID UNI1829

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 25712673..25715777 210
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022272 (Myo10) NM_019472 myosin X Gene [Source:MGI (curated);Acc:Myo10-001]

 
Come back to gene ENSMUSG00000022272


For any suggestions or comments, please send an email to unitrap@crg.es