Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14131E7
Clone ID IST14131E7
Vector VICTR74
Project tigm

Sequence tag IST14131E7HMR1
Sequence
TTCCAGTGTGTAAAACTCTGTTTCCAAAGTAGGCTTAGACTTGAGTAGCTTTCTTTACCTGCCACTGGTTATCCCACTCT
GGAACAGAGCAGTATTTCTCTCCTGTCCTCTCAGAACTCCTTAACAGGTAGTTTCTTTGCTATCTCTCAGGCTGTTCTTT
GCTCTTGAAATCTCGACAGACATGATCAAATCAATGCTCTCNCTCTTTGCTCCTCTTTTGAACCCTTGAGTTTTCCCCCT
CTCTCTTCCTCAGCTTTTCTCCTCANTGGTTTTCTCACCTTCTTTGATCCCTTTCCNGTCCTCTCAGCATGACCTGCANN
NNTGGCANCTGGACCCNTGNTCTTGNGGNTN
Sequence Type genomic DNA
Unitrap ID UNI32914

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 31148439..31148786 326
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000296 (Tpd52l1) NM_009413 tumor protein D52-like 1 Gene [Source:MGI Symbol;Acc:MGI:1298386]

 
Come back to gene ENSMUSG00000000296


For any suggestions or comments, please send an email to unitrap@crg.es