Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15051C2
Clone ID IST15051C2
Vector VICTR80
Project tigm

Sequence tag IST15051C2HMF1
Sequence
GGTTTGACCCGATCAAACTCCCTTTTTATTTGGGAGGAAGGATCTAGGCTGTTGCCGTGCAAAGAGTCCATATGGGCCCC
AGCATTCCCTTTCATGGACACCCCCCCCCCCAN
Sequence Type genomic DNA
Unitrap ID UNI11419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 71026267..71026378 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022099 (Epb4.9) NM_013514 erythrocyte protein band 4.9 Gene [Source:MGI Symbol;Acc:MGI:99670]


Sequence tag IST15051C2BBF1
Sequence
GGTTTGACCCGATCAAACTCCCTTTTTATTTGGGAGGAAGGATCTAGGCTGTTGCCGTGCAAAGAGTCCATATGGGCCCC
AGCATTCCCTTTCATGGACACCCCCCCCCCCANNNTTN
Sequence Type genomic DNA
Unitrap ID UNI11419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 71026267..71026378 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022099 (Epb4.9) NM_013514 erythrocyte protein band 4.9 Gene [Source:MGI Symbol;Acc:MGI:99670]

 
Come back to gene ENSMUSG00000022099


For any suggestions or comments, please send an email to unitrap@crg.es