Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11922C7
Clone ID IST11922C7
Vector VICTR76
Project tigm

Sequence tag IST11922C7BBF1
Sequence
TGGGTAAGAGCACCCGACTGCTCTTCCGAAGGTCCGGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCCGT
AACGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI32919 UNI32920 UNI32921

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 10239526..10239616 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 20876369..20876459 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 33175193..33175283 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 16545007..16545097 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 31444954..31445044 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 56946898..56946988 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 109526221..109526311 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77892165..77892255 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 20197428..20197518 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 92070090..92070180 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 75521877..75521967 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020226 (Slc5a4b) NP_075708 solute carrier family 5 (neutral amino acid transporters, system A), member 4b Gene [Source:MGI (curated);Acc:Slc5a4b-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 25457470..25457560 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 49015792..49015882 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52139275..52139365 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002968 (Med25) NM_029365 mediator of RNA polymerase II transcription, subunit 25 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1922863]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 53300519..53300609 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 11041623..11041713 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 99017659..99017749 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004233 (Wars2) NM_027462 tryptophanyl tRNA synthetase 2 (mitochondrial) Gene [Source:MGI (curated);Acc:Wars2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 111292050..111292140 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 79517139..79517229 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 90593564..90593654 91
NO GENE  


Sequence tag IST11922C7HMF2
Sequence
TGGGTAAGAGCACCCGACTGCTCTTCCNAANGTCCGGAGTTCAAATCCCANCAACCACATGGTGGCTCACAACCATCCGT
AACGAGATCTGACGCCCTCTTCTGGAGTGTCTGAAGACAGCTACNGTGTACTTACATATAATAAATAAATCTTTAAAAAA
AAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 38903052..38903217 158
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 103382342..103382507 158
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127484379..127484544 158
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 88435711..88435876 158
NO GENE  

 
Come back to gene ENSMUSG00000004233


For any suggestions or comments, please send an email to unitrap@crg.es