Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10681B5
Clone ID IST10681B5
Vector VICTR76
Project tigm

Sequence tag IST10681B5HMF1
Sequence
CTACATTCTACATTTCACTTTGAATAATGCTTTTTTTTTTTTTTTTTTTA
Sequence Type genomic DNA
Unitrap ID UNI32648

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 63457196..63457244 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021461 (Fancc) NM_007985 Fanconi anemia, complementation group C Gene [Source:MGI Symbol;Acc:MGI:95480]


Sequence tag IST10681B5BBF1
Sequence
CCGATAGCCTCTTAACGTGGCGCGCGCCCCTGCATCGGGCGGCGCAGGGTGCATTTCTCCCGGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 162880649..162880716 68
NO GENE  

 
Come back to gene ENSMUSG00000021461


For any suggestions or comments, please send an email to unitrap@crg.es