Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10092B8
Clone ID IST10092B8
Vector VICTR75
Project tigm

Sequence tag IST10092B8BBF1
Sequence
GTATTCTGCTGCTGATGCTCAAATCTATGGTTCCAGATTTCTTTCCTAGGGTTCCTATCTCTAGTGTTGCCTCGCTTTGA
GTTTTCTTTATTGCGTCTACTTCCCTTTTTAGGTCCAGG
Sequence Type genomic DNA
Unitrap ID UNI32376 UNI32928

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 78511087..78511204 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021065 (Fut8) NM_016893 fucosyltransferase 8 Gene [Source:MGI Symbol;Acc:MGI:1858901]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 40232206..40232323 112
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 53070237..53070354 112
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 126737470..126737587 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034480 (Diap2) NM_017398 diaphanous homolog 2 (Drosophila) Gene [Source:MGI (curated);Acc:Diap2-001]


Sequence tag IST10092B8HMF1
Sequence
TTATTCTGTTGCTGATGCTCAAATCTATGGTTCCAGATTTCTTTCCTAGGGTTTCTATCTCTAGTGTTGCCTCGCTTTGA
GTTTTCTTTATTGTGTCTACTTCCCTTTTTAGGTCTAGTATGGTTTTGTTCATTTCCATCACCTGTTTGTATGTTTTTTC
CTCTTTTTCTGTAAGGACTTCTACCTGTTTGATTGTGTTTTCCTGTTTTTCTTTAAGGACTTGTAACTCTTTANCAGTGT
TCTCCTGTATTTCTTTAAGTGATTTATTAAAGTCCTTCTTGATGTCCTCTACCATCATCATGAGATATGCTTTTAAATCT
AGGTCTAGGTTCTCAGGTGTGTTGGGGTTCCCTGGACTGGGCGAAGTGGGTGTGCTGGGTTCTGGTGATGGTGANTGGTC
TTGGTTCCTGCTAGTAAGATTCCTCCGTTTACCTTTCGCCATCTGGNNATCTCTGGANTTANTANTTATAGTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 88976489..88976960 458
NO GENE  

 
Come back to gene ENSMUSG00000034480


For any suggestions or comments, please send an email to unitrap@crg.es