Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14980E4
Clone ID IST14980E4
Vector VICTR76
Project tigm

Sequence tag IST14980E4BBF1
Sequence
NNGGNNNNNNTGGGAGTAGGGCAAGAGATTGTGAACTGGACACATCGCAGATGCCAGTTACATTTATTTTGTTTTATTTT
ATTTTATTTTTTTGAGGCAGACCTCTCTTTGAAGCCCAAGCTGGTCTGAAATTCACTATGTANACCATGCCTACCAAGCA
CTAAAGGTGTGTGCTGCTGTTGTGGGCACTCTCCAGCCCAAATTACAGCTGGTTCATTTCAGCACTTANATACACGTGGA
TGCTTCATAATTGAGCTATTGATACATATTGAGGTTAAAAAGAAAAGAATAACCNGAGTCTGTTGAGTGAAGTGTTTTTA
TTTCNTTGTGTATGAGTATATCCNTCTGTGGGANAGATTCNGGAGGCANNNGGAATTTTTTGATTNNNCNANNTN
Sequence Type genomic DNA
Unitrap ID UNI18463

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106976172..106976546 353
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040481 (Bptf) bromodomain PHD finger transcription factor Gene [Source:MGI (curated);Acc:Bptf-002]

 
Come back to gene ENSMUSG00000040481


For any suggestions or comments, please send an email to unitrap@crg.es