Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13140F4
Clone ID IST13140F4
Vector VICTR74
Project tigm

Sequence tag IST13140F4HMF1
Sequence
TTANCACCCGACTGCTCTTCCGAAGGTCCNAANTTCAAATCCNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13140F4BBF1
Sequence
CTCTCATGTGAGGGAGGCCCTCTANATGCTTCCTGGCACATAGGACTCATTGTTGTCTTCTCCCCCTATTGTCCTTGGAA
AAGAGGCACCAGCTACTCAAGGCCGGATCAACAGAAGTGGGCAGTAAAACAGTCACATGGTAAACTGCACGTGTCANAAT
AAGGCTGGGCTCTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI15271

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20612724..20612903 176
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es