Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10874G4
Clone ID IST10874G4
Vector VICTR76
Project tigm

Sequence tag IST10874G4BBF1
Sequence
ATGCCAGGCAAATAGACAAACTATAAAACAGCTAACTTACAACAAATGTGGTTGGTTACTTCTTAACTTCAGGACTGGAG
AAGGAATGGAAATTGTCACCAAATGTATGAATGGAACATGAGTGGTATTCANAGAGGTCTTTTCCTTANATAAACTAAAT
AAAACCAAGTTATCCATCTAGTTTCTGGGGAGAAATACACATCTGTTTTTAGACCCTTGAAGGATTCATGCANATCATTT
CCTTCAATAGTTGCAAAAAGTATTTCAATGGCTCAGANTTCATACGGTTATCTACAGGAACACAGCACACTANCCATGAN
AACTATGACTCTAAGTTTCAACCCCNNACCTTTACCTACTACACTTTTGAATTTTTCGGATACCATTGTTNNNTTTCTTT
TTN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86552846..86553247 380
 
EST/CDNA Est Name
  CD555312.1 - AI747368.1 - CF902610.1 - AI956722.1 - CJ099883.1 - CJ099580.1 - CJ103609.1 - CJ102220.1 - CJ173844.1 - CJ103656.1 - BY234701.1 - BY233877.1 - BY236535.1 - BY177467.1 - BY178133.1 - CJ103480.1 - BY192888.1 - BY320516.1 - BY222134.1 - BB840649


Sequence tag IST10874G4HMR1
Sequence
GCATTAGAGTATATCTTGAGCTTGTAAAACTGGTTAATGTTCTACTTTAATGCCATGTGTGTATTAATGGTTATATAGCT
ACTTGGCTTTTTGTCCTCGGTGCTATGTCTAAGTTATAACTACATTTTATTACTGGTTATACCTGTAGTACTTGAGGAGT
TAAAGGGAAGTGAAAGTAAAAGAGTCTTAGTCCTATTCTGGACCTTACTCAGATCCTGGCCTGTTTGTAGCAGGAGAGTT
TGATGTAAGATACAGCTGACATTGCTCAGCCAGCACAGTAAAGGGAATGCACAGCTGGGGACAAGGGCTTTTTCTCAGTT
TACAACATGAAAATTCACTACCATGGAGGGAAGAGGGCAGGATGGGACTGCTCTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI29524

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86552468..86552849 382
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047126 (Cltc) NM_001003908 clathrin, heavy polypeptide (Hc) Gene [Source:MGI (curated);Acc:Cltc-001]

 
Come back to gene ENSMUSG00000047126


For any suggestions or comments, please send an email to unitrap@crg.es