Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14384E5
Clone ID IST14384E5
Vector VICTR74
Project tigm

Sequence tag IST14384E5HMR1
Sequence
NAGGATTGCTGTGGACAAGTCNNAGCTACACAGCAGAATCCTTCTGTAGAAAAAGAAGGTCCACATGCCATATGGGTTTT
TTTGTTTTGTTTTTTGAGACAGAGGGGTACTCTGTGTAACAGCCCTGGCTCGCCTAGAACTCACAGAGATCAGCCTGCTT
CTGCCTCCCAAGTGCTAGGATT
Sequence Type genomic DNA
Unitrap ID UNI11597

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164649371..164649551 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017764 (Zswim1) NM_028028 zinc finger, SWIM domain containing 1 Gene [Source:MGI (curated);Acc:Zswim1-001]


Sequence tag IST14384E5HMF1
Sequence
CTCTCACCTCAGCTTCCAAGTGCTGCAAATAAGGCATGTGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164649331..164649372 42
NO GENE  

 
Come back to gene ENSMUSG00000017764


For any suggestions or comments, please send an email to unitrap@crg.es