Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10905G8
Clone ID IST10905G8
Vector VICTR76
Project tigm

Sequence tag IST10905G8HMR1
Sequence
GATATCCCTTCNCAGTGATAAACAAGGACAGAACTTAGTCCCACCCACAAGTTCCAAGAAGTCAGTAGGAAGTAGCTGAG
GAACTCCAAAGCCACAAAGGCCTTCCTTAGGGCCCAGTGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI25304

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 28164339..28164462 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021895 (Arhgef3) NM_027871 Rho guanine nucleotide exchange factor (GEF) 3 Gene [Source:MGI Symbol;Acc:MGI:1918954]


Sequence tag IST10905G8BBF1
Sequence
TATCCTGGCTTCCACCCCAACCCCTCTGGGCTGGGTAGGAGAAAAGCAAGCCTTGGGCCTTCCAACCCTGCTTTANAGTT
GAGGAAACTGGCGTGTACAAATCTCAAGACTACTTTTAAGACATTTTGTAGGCTCCCGGGGAGCTTANGAACAGACTCAC
AAAAGCCTNTGCAGAAGGTAACAACGTTCCTGTTANTTTGATCAAAGAATGTANCANTTCTTTACAAAGTATACTGGGAT
AAATATAANCNNNNNTTCCTANCCNNANACTATTATTTTANNACCTNNNGCCNATAATGTAACCTNCTGNGGCTTGGTTT
GCTANCTGNNAANTACAATGACCCTCCTANAGTTGTGTGGGGGAGCATGGNNNACTCTGTGNAATGTGTGTGTCATANGC
CCNCCNNNNNGGGAN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000021895


For any suggestions or comments, please send an email to unitrap@crg.es