Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10933H2
Clone ID IST10933H2
Vector VICTR76
Project tigm

Sequence tag IST10933H2HMF1
Sequence
GCAGAAGCCTTGGATGCCAAGGCACCCTGGCAACCCAGGCCTTCTGCACATCCAGCCCAAGGTTGTTA
Sequence Type genomic DNA
Unitrap ID UNI9144

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 49641246..49641312 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055653 (Gpc3) NM_016697 glypican 3 Gene [Source:MGI (curated);Acc:Gpc3-001]

 
Come back to gene ENSMUSG00000055653


For any suggestions or comments, please send an email to unitrap@crg.es