Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10683G10
Clone ID IST10683G10
Vector VICTR76
Project tigm

Sequence tag IST10683G10HMF1
Sequence
ACTAGAACAAATTAATNAAATAATCAGCAAATACCAGACACTTTCTTCATTGTATGTTGGTATGCTGACATCAACGCCTT
AATTTTGTTTCCCTTTGTGGGGAGGTGCCTGTCAGGTGACACAGTAGGAAAGGGGCATTCATGACTTCTGAGCCTTTGGT
CTTTTCCTGANTCACCAAGCAGACTGACCGTCAGCTAGGGGAGACCAGTGTCCACTTCTGGTTCTGGTTCTGCTTCACTG
TTTTCTTGGAAAGAAAGAAATGTAATAGTTCTAGGTAATTCAGAAGAACTACCATCACCATGCTGTTATTTATTCNCTTG
CTTTTGGTTTTCTTATGTACNAGTTTTGATAAAAGAGTGAGAANGACTGTTATCTAAAATACAAATGGATCATTATCATA
CCTGGAAAAATTTTAATATTGGCAGACATGTGTCTATAATACCCTTGTTTCTCCTTGTTTCNNAGAACTTCTTCCCGGAN
CAGANGGTCNATTGGTGCCAGCANTCNNACGGTGGA
Sequence Type genomic DNA
Unitrap ID UNI29422

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11845986..11846500 489
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020176 (Grb10) NM_010345 growth factor receptor bound protein 10 Gene [Source:MGI (curated);Acc:Grb10-005]


Sequence tag IST10683G10BBF1
Sequence
ACTAGAACAAATTAATCAAATAATCAGCAAATACCAGACACTTTCTTCATTGTATGTTGGTATGCTGACATCAACGCCTT
AATTTTGTTTCCCTTTGTGGGGAGGTGCCTGTCAGGTGACACAGTAGGAAAGGGGCATTCATGACTTCTGAGCCTTTGGT
CTTTTCCTGANTCACCAAGCAGACTGACCGTCAGCTAGGGGAGACCANTGTCCACTTCTGGTTCTGGTTCTGCTTNNCTG
TTTTCTTGGAAAGAAAGAAATGTAATAGTTCTAGGTAATTCNNAAGAACTACCATCACCATGCTGTTATTTATTCNCTTG
CTTTTGGTTTTCTTATGTACNAGTTTTGATAAAAGAGTGAGAANGACTGTTATCTAAAATACAAATGGATCATTATCATA
CCTGGAAAAATTTTAATATTGGCAGACATGTGTCTATAATACCCTTGTTTCTCCTTGTN
Sequence Type genomic DNA
Unitrap ID UNI29422

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11846043..11846500 440
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020176 (Grb10) NM_010345 growth factor receptor bound protein 10 Gene [Source:MGI (curated);Acc:Grb10-005]

 
Come back to gene ENSMUSG00000020176


For any suggestions or comments, please send an email to unitrap@crg.es