Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12862C11
Clone ID IST12862C11
Vector VICTR76
Project tigm

Sequence tag IST12862C11HMR1
Sequence
GAACAACCCGTTGAAACAGAAGTAAGACCAACTCTCTGACACCTGCACAGCCCAACCTGAGCTCACAGCAACACCTAGGC
CTCCAGGAGGTCCCAAGTTCCACACATGTCCCTGACACCAAATTGTGTGTGTGTGTGTGTGTN
Sequence Type genomic DNA
Unitrap ID UNI32812

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57883747..57883888 142
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037716 (Ccdc33) NM_029212 coiled-coil domain containing 33 Gene [Source:MGI (curated);Acc:Ccdc33-001]


Sequence tag IST12862C11HMF2
Sequence
TNNNNACTNANACTCTNNNNNTTTCTTTCTTACTACCCGGGGCTTGCTGGCTCCCCCTCTGCTGGGTGGCCTTCACTTTA
TGACTCATCCGATGCCTGGCTGGATCTAGGGCTCAGAGCTTGGCTGAAGGANNNCNCTGATATCTCAACAGAGGATATTC
ATCTTCTGTACTTTCCTCGATGCTTCAGTATCTTATGCTGCTCTGATTAGAGTGGCCCCAAATGGGGTTATTAGCTTATA
TGGTTATCGCCTCCATACATACACAGTCCCATGTGCACAGATACAGGAAATCATATTCAAGGATGATCCATGCAGCACAG
TCTATAGTCTTACACTAACTACTGCTTCTCTGGTGCCTGGTCTGTCTGTAAGGAATGTCCTAGAATTAATTGTCCTTGTA
CAGAGAGTAGGCCAGACTATTGCGAAATGAAGAGATCATGTGGGGAGTCNACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57883890..57884336 423
 
EST/CDNA Est Name
  CB274069.1

 
Come back to gene CB274069.1


For any suggestions or comments, please send an email to unitrap@crg.es