Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14979G4
Clone ID IST14979G4
Vector VICTR76
Project tigm

Sequence tag IST14979G4HMR1
Sequence
NAGGTCTTCTAAAATATGAATTGTTAAACTGGGCGTGGTGGCCCATGTCGTTTCAGAGGCTGAGGCAGGAGGATTGCTGA
AAGTTTGAGGCCAGCTTGTTCTACCCAGTAAATTTTAAGCAATTATAACCCCAACTCCATACATATTTATTCAAGTTGTT
TGCTTCCTATCTATATAGCCTCTTGCCAGTGGTACTCAGTTC
Sequence Type genomic DNA
Unitrap ID UNI9428

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95621395..95621594 200
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028106 (Rprd2) NM_001081293 Regulation of nuclear pre-mRNA domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1922387]


Sequence tag IST14979G4HMF1
Sequence
CTCTTTTCTGTATTAAAGCANTGTTGTGGGGAGAACCACACAGGTTGAAAAAAAAAATTATANCTTGAAATGGGGGTTAT
ATNCTAAAACAAATAATTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000028106


For any suggestions or comments, please send an email to unitrap@crg.es