Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14870E4
Clone ID IST14870E4
Vector VICTR76
Project tigm

Sequence tag IST14870E4HMF1
Sequence
ATTCGACTAGGCACCTCGGGGCAGAAAGATGACTCAGCAGTCTGACCGCTCTTCCATAGGTCCTGAGTTCAATTCCCAGC
AACCACATGGCTCACAACCATCTGTAATAAGCTCCGATGTCCTCTTCTGGTGTGTCTGAAGACAGCTACTGTGCACTCAT
AACACACAAAATAAATAAATAAATCTTAAAGACAACAACAGCAACTAGGCACCTCCCCTCATATTAAGGCTGGACGGGGC
AACCCAGTTAGGAAGACAAGGGTTCCCAAAGCAGGCAAAAGCATCAGAAACAGCCTCCATTCCCTCTGTTAGGAATCCCA
CAGAAACACAGTTACACAACTGTAACATTCGCAGAGGGCTTACGTTAGACCATGCAGGCTCCCTCATTGTCNGCTCANAC
TCTGANTCCCTATGAGCCCTGGTTGATGCTGTGGGGTTCTTGACCTCTCTGGCTCCTACAACCCNAGAANGANGCTTCNT
NNGGTACAAGAGAACTGAGCCNANNCTGACATGANTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 26641951..26642465 487
NO GENE  


Sequence tag IST14870E4HMR1
Sequence
ATTGCATCGAGTGATATGTCATGTCTGGTTGATATCCCTGGGAAGCCTGCCCATTTCGGAAGAGAAACAGAGGAGTGGAT
GGGGAGGGGAAACCGGGGTCAGGATGTNNTATATAAAGAATAAATTAATTTAAANAAN
Sequence Type genomic DNA
Unitrap ID UNI30729

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 26642464..26642600 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031565 (Fgfr1) NM_001079909 fibroblast growth factor receptor 1 Gene [Source:MGI (curated);Acc:Fgfr1-001]

 
Come back to gene ENSMUSG00000031565


For any suggestions or comments, please send an email to unitrap@crg.es