Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14287B1
Clone ID IST14287B1
Vector VICTR74
Project tigm

Sequence tag IST14287B1HMR1
Sequence
GTACCATTAAATTACATCACAGCCACTGAACCTCATTTATATTANCTTGTAATGTATGGAAATTTTAAAGAGGAGGAGCT
AGAGAGATTGCTCAGTGGTTGAGAGCTCTTGCTGCCCATGGANAGGACCCCANTTTGGTCCCCAGCACCCACATTGTGGC
TCTCAACCATTTGTAACTCANTCCTANGAAACCCAACACCTTTTGACTTATATGGGCACCAAGCCTGCATGTGATGCACA
TACATGCAGGCACAACACACATGCATATGCNNAAATACTTAAANANAATTTTTGAAAGGGAAAAAAAAANNNCC
Sequence Type genomic DNA
Unitrap ID UNI17235

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72842980..72843288 291
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034563 (Ccpg1) NM_028181 cell cycle progression 1 Gene [Source:MGI Symbol;Acc:MGI:1196419]


Sequence tag IST14287B1BBF1
Sequence
NTNNNNNNNNNNCTTNNNATGTATCNGGCNNTAGGTTNNNNCCNNTTCANTTTGAGCATTNANNANANATTTTGGGGAGA
TNANANNNTANCTGANACNTGTCTNACCNAANCCACCANTTANCCNAAATCTTGCTGTATAACTAANCTANCCTANAATG
TGGGTCTTTCCTGCNTCAGCTTTCCCAGTACTAANGCTATGTTACTTCTAATTCTAATTAAGTANCTGTGTTAATGAANG
TATTCTTTGTGCTTATATGTACGTTCGTGGGTGCACATGCCTGTACGTGTCCCTGCATGCATGCNCACACATAANGATGC
CAAAGGACAANAGTGGCAAGCANTCCTCGTGGTTTTAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000034563


For any suggestions or comments, please send an email to unitrap@crg.es