Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A056B05
Clone ID A056B05
Vector pT1betageo
Project ggtc

Sequence tag A056B05
Sequence
TACGTGGCCCCCTTGGCTGAGGGCCTAGGTGGCCACGTGGAGCAGTTGGTAGCTCGGAGTAACATCATGACATTGCTCTT
CCAGTGTATGCAGGATTCCATGCTGAGCTTCGGACACCACTGGCCNNTTGTGGCAGACCTTACCAAAGCTTGCTTTATCC
ACGTCAAGCCCTGTATAGCTGAGTTCATGCCTATTCTGGGTACCAACCTGAACCCTGAGTTCATCTCTGTCTGCAACAAT
GCTACCTGGGCCAGGGGGGAGATCTGCATGCAGATGG
Sequence Type mRNA
Unitrap ID UNI6749

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87575865..87577753 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031691 (Tnpo2) NM_145390 transportin 2 (importin 3, karyopherin beta 2b) Gene [Source:MGI Symbol;Acc:MGI:2384849]

 
Come back to gene ENSMUSG00000031691


For any suggestions or comments, please send an email to unitrap@crg.es