Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14585C9
Clone ID IST14585C9
Vector VICTR74
Project tigm

Sequence tag IST14585C9HMF1
Sequence
ACCATTAGTCTTTGCTGACCTACAGATCCTTTGTAAGGTGCANNNNNGTCCTCATTCCCTTTCTTTAATTCCTGGCCCCC
ACTGATCGTTTTTACTAACTCCATTGTCTTCTCTTTTCCAGAAGTCAGTGGGATGGGTACAGCATGTAGCTTTGAAAGAC
TGATATCTGTAGCTTAGTAATACACACAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 12335912..12336102 181
NO GENE  


Sequence tag IST14585C9HMR1
Sequence
ATGGTGATTTATGTNNTTGCTCCTTTGTGCTANACTACAGGATGCACAGCACCCANAGGGAAAGGTAATGCCAACCGCAG
TTGTTGGCAACAATGATGTCTGCTACAGTGCTCCAGTTTTAACAATGTGTGGCTGTGACAGGTTGTGCTGGTANTGGGAA
TGGTTGTGCCTGTGTAN
Sequence Type genomic DNA
Unitrap ID UNI15084

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 12335741..12335916 166
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020173 (Cobl) NM_172496 cordon-bleu Gene [Source:MGI (curated);Acc:Cobl-003]


Sequence tag IST14585C9BBF1
Sequence
ACCATTAGTCTTTGCTGACCTACAGATCCTTTGTAAGGTGCAAGTCTGTCCTCATTCCCTTTCTTTAATTCCTGGCCCCC
ACTGATCGTTTTTACTAACTCCATTGTCTTCTCTTTTCCAGAAGTCAGTGGGATGGGTACAGCATGTAGCTTTGAAAGAC
TGATATCTGTAGCTTAGTAATACACACAGTTAACAGCCCTTCATGTCCTGTCCTAGCTTGATTCACTATTTCCTTTTAGT
GCTGGATAAAGCTCCATTGTCTGGATGTGAATGACAAGTGAAGTTTCAAAGCAGCAGCAGGAGAGGGGCTCAAGCACCAG
GAAGGTGCTATTGGTTCAGTGCTGCTACAGAAGCTACTCAGGGTGTACAGCCGCTACACGAGCTAGGTAAAGTGAACAAT
GGTAATGAATAGAGACCAGAATTCNNAGCAACCCTGGCTNANTNTGCTCTTCTTTTCCNNNTCNTGGACTCAGCANATCC
TGGAACNNGANGGCNNGCAAAANAATACACNCAGAAATCTGGANAAGTNCCNTGCNCCCCTGCTATCTGCCCNNCNNNAA
NCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 12335912..12336462 506
 
EST/CDNA Est Name
  BY714089.1 - AA596970.1 - CJ166430.1 - CJ168062.1 - BY021325.1 - CJ181280.1 - CJ185221.1 - CJ112536.1 - CJ185217.1 - CJ186320.1 - CJ109498.1 - CJ108296.1 - CJ111103.1 - CJ115742.1 - CJ108083.1 - CJ127225.1 - CJ110048.1

 
Come back to gene BY714089.1 - AA596970.1 - CJ166430.1 - CJ168062.1 - BY021325.1 - CJ181280.1 - CJ185221.1 - CJ112536.1 - CJ185217.1 - CJ186320.1 - CJ109498.1 - CJ108296.1 - CJ111103.1 - CJ115742.1 - CJ108083.1 - CJ127225.1 - CJ110048.1


For any suggestions or comments, please send an email to unitrap@crg.es