Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11568H3
Clone ID IST11568H3
Vector VICTR76
Project tigm

Sequence tag IST11568H3HMR1
Sequence
CGGTAGGAGGAAGGATCTGGACTATTGATCTCTTCTCAGGGCTTACTGCTGATCCAGTAGTCACTCTCCATTTGGGTAGG
GAAGATGCCAGAAGCTGCAATCAATAAAGACTTTTACTCCCTCNNAACCNNTAACTTTGCTTTGAAANACNNNNAACNNC
NNNNNANNTNNNNNCCNANATTTTGTGGCTTCCCAAAGTGCTGTGATTTGTTTCTTCCTAATANTGCCTTTTGTTCTGTG
GAAAAATTTCTTCTTTGGTTCTTTGAGGTTTANATTTCTTTCCTAANGTATTTTTAGAAAAAGGGAATCAGTATGTN
Sequence Type genomic DNA
Unitrap ID UNI30221

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4733221..4733536 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009073 (Nf2) NM_010898 neurofibromatosis 2 Gene [Source:MGI (curated);Acc:Nf2-001]


Sequence tag IST11568H3HMF1
Sequence
CCGCCACAAGCAGCCTGTGACATCAGTGGCCTAGTCTAAGTAGGCTCTAGTGTTTTCATCCCTAACTCCTCCAAGCTTTG
TGTAACCTCCAGATTTTGGGCTGGAGCAAGGGGGATGCACTTGTTTCAAAGTCAGCTAACAAACAGATGACAAAGCAAAA
AAAAAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4733534..4733709 176
NO GENE  

 
Come back to gene ENSMUSG00000009073


For any suggestions or comments, please send an email to unitrap@crg.es