Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W204A01
Clone ID W204A01
Vector ROSAbetageo
Project ggtc

Sequence tag W204A01
Sequence
AGCTGTGAGAGACTNCTNNNTCAANNNCGCAGTAACCCAGTTCCCCAGTGGGGCGTACGACAGGTGCCTTAAGCTCTCCG
ACACCGATACAGGACAGTGTATATCAAGATTTACAAACCGCAAAGTACCCTACTGCGTCAAGTTCAATCCCGATGAAGAT
AAGCAAAATCTCTTTGTGGCTGGGATGTCTGATAAGAAGATCGTACAGTGGGACATCCGCAGTGGAGAGATTGTTCAGGA
ATATGATCGGCATCTGGGGGCTGTCAACACGATTGTTTTTGTTGATGAGAACCGAAGATTCGTGAGTACATCTGATGATA
CAAGCCTACGAGTTTGGGAATG
Sequence Type mRNA
Unitrap ID UNI12201

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 40561160..40562939 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038446 (Cdc40) NP_082155 cell division cycle 40 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1918963]

 
Come back to gene ENSMUSG00000038446


For any suggestions or comments, please send an email to unitrap@crg.es