Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12917F2
Clone ID IST12917F2
Vector VICTR76
Project tigm

Sequence tag IST12917F2HMF1
Sequence
CCCGTACTCTGCATGGTCAGTGGTACCTGGTCAAGCACTTGGCACTCAAGCAAGAATCTTCACTCCATTCCCTCCTGGCC
CCTCCTTCCAGTGTGGCCTCCTCACAGAGGAAGTAACTAGACACTCCCAAAATCTGCATTCCGGGGATGACCTTAGGAAG
ATAGGAATGAAGTCTCTTTCTTACTTTGTCTCCTCTTTTGGATTCAGGCCGTGAGATGTAGCTTGAGGGGCTGATTTCTG
TGCCTCGCAGAAAATCTGCATCTGTTGGTGAGGCAGGTCTTGCATGGTGCCTAGATGCCCTCCCTGCCTGGGGGAGAAAG
TGCCAGTTA
Sequence Type genomic DNA
Unitrap ID UNI29874

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22426914..22427241 328
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]

 
Come back to gene ENSMUSG00000013089


For any suggestions or comments, please send an email to unitrap@crg.es