Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10762G8
Clone ID IST10762G8
Vector VICTR76
Project tigm

Sequence tag IST10762G8HMR1
Sequence
TACCATGACAGTCACTGCAGANAAGGGGACTTGATAGCGTTTTCTGTAGGCCTGACAAACCTGGCTGAGTGGGAACACCA
ACTGTTGGCGGGACTNNGGGCTTTGGGGGTTAGTGAAGCGCACAGCAACTTACTTGGCAGCCATCTGGACATGTTTGTTG
TGGTGACCGTGGGGGGTTCCAGGGCANTTGTGCTANCCACANAAAGCTACNTGANCTGTAATTGGACTCTGTNCNTACAA
ATATGTTCCTTGCTTATGTACN
Sequence Type genomic DNA
Unitrap ID UNI10771

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 110368310..110368570 241
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020186 (Csrp2) NM_007792 cysteine and glycine-rich protein 2 Gene [Source:MGI Symbol;Acc:MGI:1202907]


Sequence tag IST10762G8BBF1
Sequence
GTATGTGGGGACAGTCTCCAAACATGGTCTGATGTGATGTGAAATCCCAGACTATCTATGATGTAGGGGCAACATTCGCT
AATTCCCCTTAACAAACCGGCCTCCCGGGACAGCTTAACTGGCTGATTTCGGAATGTCAGCGTTCTCAACTGCCTGAGCA
AGCCAGCCGGCTAAGAAGGGACCTTGTTTCTGTGGTCTACTCCCTTTCCCCCTAACACCGATTTTTGGGCTTCCCTTCTG
TGAGGGGTATTTGCAGCCTTTGCCTGCTAAGTTTCTGGATGTGGCCCTTGCCTCTTTAAAAAAATGGCTGGTTGTAAAAG
TTGGCATTTCCTTTATAAATATAAACCTGATTAGAACACACGTTAGTTCTGGTAAGCAGANGAAAAGCTTCCATCTTTGC
CCTTAAAAGGGCGTGATTTCCCATACAACCATTAAAATGGGTGCAGACCTCTATNNNNTTTCCTGATGANNCCTTTATNA
AATATTTAAACNNTTAGTACANNNTGCNTNGNCCCTCTTCTGGTNACCCCCCNCCCCCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 110367774..110368312 503
NO GENE  


Sequence tag IST10762G8HMF1
Sequence
GTATGTGGGGACAGTCTCCAAACATGGTCTGATGTGATGTGAAATCCCAGACTATCTATGATGTAGGGGCAACATTCGCT
AATTCCCCTTAACAAACCGGCCTCCCGGGACAGCTTAACTGGCTGATTTCGGAATGTCAGCGTTCTCAACTGCCTGANCA
AGCCAGCCGGCTAAGAAGGGACCTTGTTTCTGTGGTCTACTCCCTTTCCCCCTAACACCGATTTTTGGGCTTCCCTTCTG
TGAGGGGTATTTGCAGCCTTTGCCTGNNAAGTTTCTGGATGTGGCCCTTGCCTCTTTAAAAAAATGGCTGGTTGTAAAAG
TTGGCATTTCCTTTATAAATATAAACCTGATTAGAACACACGTTAGTTCTGGTAAGCAGANGANAAGCTTCCATCTTTGC
CCTTAAAAGGGCGTGATTTCCCATACAACCNTTAAAATGGGTGCAGANCTCTATTANNTTTCCTGATGANACCTTTATTA
AATATTTAAACNATTAGTACNNNGTGCNNTGNCCCTCTTCTGGTNACCCCCCACCCCNNNNNTTTTATCTAGCNTATNGT
GGAN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000020186


For any suggestions or comments, please send an email to unitrap@crg.es