Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14444C6
Clone ID IST14444C6
Vector VICTR74
Project tigm

Sequence tag IST14444C6HMR1
Sequence
CGTACACTAGCGATGTTTGTTCGAGGATTTCCTGTCAAGGACNAAGTCTCATGATGACGTATGAATCTAATCNCCTGTGA
TACCCACGTGGGCCACTGTATTATTTCATTTCCTTCCCTATTTTTTTGTGACAAAGTCTCACTCTGTAGCCCTGAATGCC
CCGGCTCTTATTATATAGACCAGGCTGGCCTCGAACTCANAGATCCNCCTGCCTCTGCCTCTGCCTCTGCCTCTGCCTCT
GCCTCTGAATGCTGGTATTAAANACTTATGCNNCCNNNCNCTGTTGTGGGGGGGGN
Sequence Type genomic DNA
Unitrap ID UNI16727

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 26645983..26646277 273
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031565 (Fgfr1) NM_001079909 fibroblast growth factor receptor 1 Gene [Source:MGI (curated);Acc:Fgfr1-001]


Sequence tag IST14444C6BBF1
Sequence
TACGGAGACAGGAAGTGACAGGACAGAGGTTGGAGACAGCAAGAAGCATGGGAAAGGCTTTTGGGGTGACACACTGATCT
CTCGACTAGGATGGTAGCAACATAAGGTGTAGGCCTTATGAAAACTCACTGAGCTGCACATTTCATACTACATAAATTAT
CCTTCAACCAACTGACTCCAGCTATGACTACTACACAGACTCTTCCACCCCTCCCCTCCCCTTCTATTCCCAGAACCACT
ACTGTGCCTAGGTTTCGTGGCACAAACCTTTCATCCCAGGCAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 26645700..26645986 287
NO GENE  


Sequence tag IST14444C6HMF1
Sequence
TACGGAGACAGGAAGTGACAGGACAGAGGTTGGAGACAGCAAGAAGCATGGGAAAGGCTTTTGGGGTGACACACTGATCT
CTCGACTAGGATGGTAGCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 26645889..26645986 98
NO GENE  

 
Come back to gene ENSMUSG00000031565


For any suggestions or comments, please send an email to unitrap@crg.es