Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14738G3
Clone ID IST14738G3
Vector VICTR76
Project tigm

Sequence tag IST14738G3HMR1
Sequence
CTTTAGCGCTTGTCTCCAGGAGCTGTTGTGGGGTCC
Sequence Type genomic DNA
Unitrap ID UNI31115

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 74370937..74370971 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038807 (Garnl4) NM_001015046 GTPase activating RANGAP domain-like 4 Gene [Source:MGI (curated);Acc:Garnl4-001]


Sequence tag IST14738G3HMF1
Sequence
CATCTATTCCNNNTCNGGAGTCTGGCNNGGANCTGGGAGTCACCTAAACCCACANANTCNCTGANTCNCGACCCGCTCNA
CCTTACCAAACTTTCTGACAAGGTTTTATGTCCCAAAATTGCANAGGTTCGTGAGTTGTCCAACATGGCTGGGTGTCAAA
GGCTANGTTGCACACCACANTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000038807


For any suggestions or comments, please send an email to unitrap@crg.es