Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A054E05
Clone ID A054E05
Vector pT1betageo
Project ggtc

Sequence tag A054E05
Sequence
CTCTAACTGCAGTGTAGCCAGTGATGATGTAGAAGATTTGGACAAGATCACAGAGGAGGGGGACGCCTCGAGTGTTGAAG
GGGAGAGGAAGTCACCATCTCAAGCCAAGGCTCCGCGGAGGAGAGCACCTTGTGAAGGCAGGGATGGCAGCAGTGCTAAC
GACACGGAGTCGGAGAGCGCCAC
Sequence Type mRNA
Unitrap ID UNI12204

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 126877558..126878190 149
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030346 (Rad51ap1) NM_009013 RAD51 associated protein 1 Gene [Source:MGI (curated);Acc:Rad51ap1-001]

 
Come back to gene ENSMUSG00000030346


For any suggestions or comments, please send an email to unitrap@crg.es