Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A053E05
Clone ID A053E05
Vector pT1betageo
Project ggtc

Sequence tag A053E05
Sequence
AGTCCCAAGCTGGTGGGTCAAGACAAGGTATCAGAAAAGGCCTCCCTCAGCTCACAGGCTGATCTCCAGAAGAAGAAGAG
GCGGGCGCCAGCTCCTCCTCCACCACAGCAGCCACCACCAAGTCCTGTGGTCCCCAACCGCAAGGAAGATAAGGAAGAGA
ACAGGAAGAGCACAGTGG
Sequence Type mRNA
Unitrap ID UNI273

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 12209617..12243785 141
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020173 (Cobl) NM_172496 cordon-bleu Gene [Source:MGI (curated);Acc:Cobl-003]

 
Come back to gene ENSMUSG00000020173


For any suggestions or comments, please send an email to unitrap@crg.es