Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11627D12
Clone ID IST11627D12
Vector VICTR76
Project tigm

Sequence tag IST11627D12HMF1
Sequence
TACTTACATATAATAAATAAATAAATCTAAAAAAAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI11007 UNI32959 UNI32960 UNI32961

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 24167618..24167661 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 33323190..33323233 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038128 (Camk4) NM_009793 calcium/calmodulin-dependent protein kinase IV Gene [Source:MGI Symbol;Acc:MGI:88258]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35171388..35171431 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 13978229..13978272 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 25647952..25647995 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022272 (Myo10) NM_019472 myosin X Gene [Source:MGI (curated);Acc:Myo10-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 53136512..53136555 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 32485690..32485733 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035933 (Cog5) component of oligomeric golgi complex 5 Gene [Source:MGI Symbol;Acc:MGI:2145130]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 5393489..5393532 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 4512913..4512956 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 12224950..12224993 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 7321681..7321724 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 4599145..4599188 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 22347976..22348019 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 17126644..17126687 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 23322236..23322279 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028999 (Rint1) NM_177323 RAD50 interactor 1 Gene [Source:MGI (curated);Acc:Rint1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 43024763..43024806 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 58959190..58959233 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 133543469..133543512 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 4819352..4819395 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 43982697..43982740 44
NO GENE  


Sequence tag IST11627D12HMR1
Sequence
AGTACACTGTAGCTGTCCTCAGANATCCCAGAAGAAGGCATCAGATTTCGTTATGGATGGTTGTGAGCCACCATGTGGCT
ACTGGGAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 14162395..14162481 85
NO GENE  

 
Come back to gene ENSMUSG00000028999


For any suggestions or comments, please send an email to unitrap@crg.es